Haplogroup I-M253

Haplogroup I-M253
Possible time of origin	15,000 BC
Possible place of origin	Europe
Ancestor	I-M170
Defining mutations	M253, M307, P30, P40

Haplogroup I1 (Y-DNA) is the original paternal lineage of Nordic Europe. In human genetics, Haplogroup I-M253 is a Y chromosome haplogroup which occurs at greatest frequency in Fenno-Scandia. The mutations identified with Haplogroup I-M253 (Y-DNA) are M253, M307, P30, and P40. These are known as single nucleotide polymorphisms (SNPs). It is a subclade of Haplogroup I. Before a reclassification in 2008,^[1] the group was known as Haplogroup I1a. The group displays a very clear frequency gradient, with a peak of approximately 40 percent among the populations of western Finland and more than 50 percent in the province of Satakunta,^[2] and around 38 percent in Sweden as a whole, with a peak of 52 percent in Västra Götaland County in central Sweden.^[3]

Origins[]

Haplogroup I-M253 arose from haplogroup I-M170, which appears ancient in Europe. Haplogroup I-M253 has been estimated to be some 15,000 years old.^[4] It is suggested that it initially dispersed from Denmark.^[5]

Subclades[]

Note: The systematic subclade names have changed several times in recent years, and are likely to change again, as new markers which clarify the sequence of branchings of the tree are discovered.^[6]

I-M253 (M253,^[7] M307.2/P203.2,^[8] L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187, L840, M450/S109, P30, P40, S63, S66, S107, S108, S110, S111.^[9]
- I-DF29 (DF29/S438)
  - I-M227 (M227)
    - I-M72 (M72)
  - I-L22 (L22/S142)
    - I-P109 (P109)
    - I-L205 (L205)
    - I-L287 (L287)
      - I-L258 (L258/S335)
    - I-L300 (L300/S241)
    - I-L813 (L813)
  - I-Z58 (S244/Z58)
    - I-Z59 (S246/Z59)
      - I-Z60(S337/Z60, S439/Z61, Z62)
        I-Z140 (Z140, Z141)
        I-L338 (L338)
        
        I-Z73 (Z73)
        
        I-L573 (L573)
        
        I-L803 (L803)
      - I-Z382 (Z382)
    - I-Z138 (S296/Z138, Z139)
  - I-Z63 (S243/Z63)
    - I-L1237 (L1237)
- I-Z131 (Z131)

Distribution by population[]

I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the Migration Period, the Viking period or modern times. It is found in all places invaded by the ancient Germanic peoples and the Vikings. In the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as United States, Australia and Canada.

Population	Sample size	I	I-M253 (M253)	I-M227 (M227)	Source
Austria	43	9.3	2.3	0	Underhill et al 2007
Belarussians: Vitbsk	100	15	1	0	Underhill et al 2007
Belarussians: Brest	97	20.6	1	0	Underhill et al 2007
Bosnia	100	42	2	0	Rootsi et al 2004
Czech Republic	47	31.9	8.5	0	Underhill et al 2007
Czech	53	17.0	1.9	0	Rootsi et al 2004
Denmark	122	39.3	32.8	0	Underhill et al 2007
England	104	19.2	15.4	0	Underhill et al 2007
Estonia	210	18.6	14.8	0.5	Rootsi et al 2004
Estonia	118	-	11.9	-	Lappalainen et al 2008
Finland (west)	230	-	40	-	Lappalainen et al 2008
Finland (east)	306	-	19	-	Lappalainen et al 2008
France	58	17.2	8.6	1.7	Underhill et al 2007
France	12	16.7	16.7	0	Cann et al 2002
France (Low Normandy)	42	21.4	11.9	0	Rootsi et al 2004
Germany	125	24	15.2	0	Underhill et al 2007
Greece	171	15.8	2.3	0	Underhill et al 2007
Hungary	113	25.7	13.3	0	Rootsi et al 2004
Ireland	100	11	6	0	Underhill et al 2007
Latvia	113	-	3.5	-	Lappalainen et al 2008
Lithuania	164	-	4.9	-	Lappalainen et al 2008
Netherlands	93	20.4	14	0	Underhill et al 2007
Russians	16	25	12.5	0	Cann et al 2002
Russia: Pskov	130	16.9	5.4	0	Underhill et al 2007
Russia: Kostroma	53	26.4	11.3	0	Underhill et al 2007
Russia: Smolensk	103	12.6	1.9	0	Underhill et al 2007
Russia: Voronez	96	19.8	3.1	0	Underhill et al 2007
Russia: Arkhangelsk	145	15.8	7.6	0	Underhill et al 2007
Russia: Cossac	89	24.7	4.5	0	Underhill et al 2007
Russia: Karelians	140	10	8.6	0	Underhill et al 2007
Russia: Karelians	132	-	15.2	-	Lappalainen et al 2008
Russia: Vepsa	39	5.1	2.6	0	Underhill et al 2007
Slovakia	70	14.3	4.3	0	Rootsi et al 2004
Slovenia	95	26.3	7.4	0	Underhill et al 2007
Sweden	160	-	35.6	-	Lappalainen et al 2008
Swiss	144	7.6	5.6	0	Rootsi et al 2004
Turkey	523	5.4	1.1	0	Underhill et al 2007
Ukrainians: Lvov	101	23.8	4.9	0	Underhill et al 2007
Ukrainians: Ivanovo-Frankov	56	21.4	1.8	0	Underhill et al 2007
Ukrainians: Hmelnitz	176	26.2	6.1	0	Underhill et al 2007
Ukrainians: Cherkasso	114	28.1	4.3	0	Underhill et al 2007
Ukrainians: Belgorod	56	26.8	5.3	0	Underhill et al 2007

Publicly accessible databases[]

There are several public access databases where I-M253 populations can be found:

Britain[]

See also: Prehistoric settlement of the British Isles

In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from northern Germany and Denmark during the Migration Period.^[10] The authors assumed that populations with large proportions of haplogroup I originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea with Anglo-Saxon migrations and Danish Vikings. The main claim by the researchers was

that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number … This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea … These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.

In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues.^[11] This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.

Famous Figures[]

See also: List of haplogroups of historical and famous figures

Alexander Hamilton, through genealogy and the testing of his descendants, has been placed within Y-DNA haplogroup I-M253.^[12]

Mutations[]

Dna-SNP — DNA example: strand 1 differs from strand 2 at a single base pair location (a C >> T polymorphism).

The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.

Name: M253^[13]

Type: SNP

Source: M (Peter Underhill, Ph.D. of Stanford University)

Position: ChrY:13532101..13532101 (+ strand)

Position (base pair): 283

Total size (base pairs): 400

Length: 1

ISOGG HG: I1

Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG

Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT

YCC HG: I1

Nucleotide alleles change (mutation): C to T

Name: M307^[14]

Type: SNP

Source: M (Peter Underhill, Ph.D. of Stanford University)

Position: ChrY:21160339..21160339 (+ strand)

Length: 1

ISOGG HG: I1

Primer F: TTATTGGCATTTCAGGAAGTG

Primer R: GGGTGAGGCAGGAAAATAGC

YCC HG: I1

Nucleotide alleles change (mutation): G to A

Name: P30^[15]

Type: SNP

Source: PS (Michael Hammer, Ph.D. of the University of Arizona and James F. Wilson, D.Phil. at the University of Edinburgh)

Position: ChrY:13006761..13006761 (+ strand)

Length: 1

ISOGG HG: I1

Primer F: GGTGGGCTGTTTGAAAAAGA

Primer R: AGCCAAATACCAGTCGTCAC

YCC HG: I1

Nucleotide alleles change (mutation): G to A

Region: ARSDP

Name: P40^[16]

Type: SNP

Source: PS (Michael Hammer, Ph.D. of the University of Arizona and James F. Wilson, D.Phil. at the University of Edinburgh)

Position: ChrY:12994402..12994402 (+ strand)

Length: 1

ISOGG HG: I1

Primer F: GGAGAAAAGGTGAGAAACC

Primer R: GGACAAGGGGCAGATT

YCC HG: I1

Nucleotide alleles change (mutation): C to T

Region: ARSDP

References[]

^ "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research 18. DOI:10.1101/gr.7172008. PMID 18385274.
^ "Migration Waves to the Baltic Sea Region". Annals of Human Genetics 72 (3): 337–348.
^ (2009) "Population Structure in Contemporary Sweden: A Y-Chromosomal and Mitochondrial DNA Analysis". Annals of Human Genetics 73 (1): 61–73.
^ Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183.
^ Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33-42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK.
^ ISOGG tree for Y-DNA haplogroup I
^ (2004) "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics 114: 127–148. DOI:10.1007/s00439-003-1031-4. PMID 14586639.
^ P, Shen et al., Reconstruction of Patrilineages and Matrilineages of Samaritans and Other Israeli Populations From Y-Chromosome and Mitochondrial DNA Sequence Variation, Human Mutations, vol. 24, no. 3 (Sep 2004), pp.248-60.
^ ISOGG tree for Y-DNA haplogroup I
^ (2002) "Y chromosome Evidence for Anglo-Saxon Mass Migration". Molecular Biology and Evolution 19 (7): 1008–1021.
^ (2003) "A Y Chromosome Census of the British Isles" (PDF). Current Biology 13: 979–984. DOI:10.1016/S0960-9822(03)00373-7. PMID 12781138.
^ Founding Father DNA & Hamilton DNA Project Results Discussion
^ M253
^ M307
^ P30
^ P40

See also[]

Ancient Germanic culture

Haplogroup
Human Y-chromosome DNA haplogroups
Haplogroup I-M170 (Y-DNA)
Haplogroup I2 (Y-DNA)
Genetic history of Europe
European ethnic groups
Late Glacial Maximum
Neolithic Europe
Germanic peoples
Norse Sagas
History of Normandy
Norse colonization of the Americas

Phylogenetic tree of human Y-chromosome DNA haplogroups ^{[χ 1]}^{[χ 2]}

"Y-chromosomal Adam"

A00

A0-T ^{[χ 3]}

A0

A1 ^{[χ 4]}

A1a

A1b

A1b1

BT

B

CT

DE

CF

D

E

C

F

F1

F2

F3

GHIJK

G

HIJK

IJK

H

IJ

K

I

J

LT ^{[χ 5]}

K2 ^{[χ 6]}

L

T

K2a ^{[χ 7]}

K2b ^{[χ 8]}

K2c

K2d

K2e ^{[χ 9]}

K-M2313 ^{[χ 10]}

K2b1 ^{[χ 11]}

P ^{[χ 12]}

NO

S ^{[χ 13]}

M ^{[χ 14]}

P1

P2

N

O

Q

R

Y-DNA by population
Y-DNA haplogroups of historic people

Footnotes

^ (2014) "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation 35 (2): 187–91. DOI:10.1002/humu.22468. PMID 24166809.
^ International Society of Genetic Genealogy (ISOGG; 2015), Y-DNA Haplogroup Tree 2015. (Access date: 1 February 2015.)
^ Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4).
^ Haplogroup A1 is also known as A1'2'3'4.
^ Haplogroup LT (L298/P326) is also known as Haplogroup K1.
^ Between 2002 and 2008, Haplogroup T-M184 was known as "Haplogroup K2". That name has since been re-assigned to K-M526, the sibling of Haplogroup LT.
^ Haplogroup K2a (M2308) and its primary subclade K-M2313 were separated from Haplogroup NO (F549) in 2016. (This followed the publication of: (2016) "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences". Nature Genetics '48' (6): 593–9. DOI:10.1038/ng.3559. PMID 27111036. In the past, other haplogroups, including NO (M214) and K2e had also been identified with the name "K2a".
^ Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.
^ Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a).
^ K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. See: Poznik op. cit.; YFull YTree v5.08, 2017, "K-M2335", and; PhyloTree, 2017, "Details of the Y-SNP markers included in the minimal Y tree" (Access date of these pages: 9 December 2017)
^ Haplogroup K2b1 (P397/P399) is also known as Haplogroup MS, but has a broader and more complex internal structure.
^ Haplogroup P (P295) is also klnown as K2b2.
^ Haplogroup S, as of 2017, is also known as K2b1a. (Previously the name Haplogroup S was assigned to K2b1a4.)
^ Haplogroup M, as of 2017, is also known as K2b1b. (Previously the name Haplogroup M was assigned to K2b1d.)

Template:Y-DNA I Template:Germanic peoples

Projects[]

This page uses content from the English language Wikipedia. The original content was at Haplogroup I-M253. The list of authors can be seen in the page history. As with this Familypedia wiki, the content of Wikipedia is available under the Creative Commons License.

[1] "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research 18. DOI:10.1101/gr.7172008. PMID 18385274.

[2] "Migration Waves to the Baltic Sea Region". Annals of Human Genetics 72 (3): 337–348.

[3] (2009) "Population Structure in Contemporary Sweden: A Y-Chromosomal and Mitochondrial DNA Analysis". Annals of Human Genetics 73 (1): 61–73.

[4] Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183.

[5] Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33-42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK.

[6] ISOGG tree for Y-DNA haplogroup I

[7] (2004) "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics 114: 127–148. DOI:10.1007/s00439-003-1031-4. PMID 14586639.

[8] P, Shen et al., Reconstruction of Patrilineages and Matrilineages of Samaritans and Other Israeli Populations From Y-Chromosome and Mitochondrial DNA Sequence Variation, Human Mutations, vol. 24, no. 3 (Sep 2004), pp.248-60.

[9] ISOGG tree for Y-DNA haplogroup I

[10] (2002) "Y chromosome Evidence for Anglo-Saxon Mass Migration". Molecular Biology and Evolution 19 (7): 1008–1021.

[11] (2003) "A Y Chromosome Census of the British Isles" (PDF). Current Biology 13: 979–984. DOI:10.1016/S0960-9822(03)00373-7. PMID 12781138.

[12] Founding Father DNA & Hamilton DNA Project Results Discussion

[13] M253

[14] M307

[15] P30

[16] P40

[vanOven2014-17] (2014) "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation 35 (2): 187–91. DOI:10.1002/humu.22468. PMID 24166809.

[ISOGG2015-18] International Society of Genetic Genealogy (ISOGG; 2015), Y-DNA Haplogroup Tree 2015. (Access date: 1 February 2015.)

[A0-T-19] Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4).

[A1-20] Haplogroup A1 is also known as A1'2'3'4.

[LT-21] Haplogroup LT (L298/P326) is also known as Haplogroup K1.

[K2-22] Between 2002 and 2008, Haplogroup T-M184 was known as "Haplogroup K2". That name has since been re-assigned to K-M526, the sibling of Haplogroup LT.

[K2a-23] Haplogroup K2a (M2308) and its primary subclade K-M2313 were separated from Haplogroup NO (F549) in 2016. (This followed the publication of: (2016) "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences". Nature Genetics '48' (6): 593–9. DOI:10.1038/ng.3559. PMID 27111036. In the past, other haplogroups, including NO (M214) and K2e had also been identified with the name "K2a".

[K2b-24] Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.

[K2e-25] Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a).

[K-M2313-26] K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. See: Poznik op. cit.; YFull YTree v5.08, 2017, "K-M2335", and; PhyloTree, 2017, "Details of the Y-SNP markers included in the minimal Y tree" (Access date of these pages: 9 December 2017)

[K2b1-27] Haplogroup K2b1 (P397/P399) is also known as Haplogroup MS, but has a broader and more complex internal structure.

[P-28] Haplogroup P (P295) is also klnown as K2b2.

[S-29] Haplogroup S, as of 2017, is also known as K2b1a. (Previously the name Haplogroup S was assigned to K2b1a4.)

[M-30] Haplogroup M, as of 2017, is also known as K2b1b. (Previously the name Haplogroup M was assigned to K2b1d.)

[1]

[2]

[3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[χ 1]

[χ 2]

[χ 3]

[χ 4]

[χ 5]

[χ 6]

[χ 7]

[χ 8]

[χ 9]

[χ 10]

[χ 11]

[χ 12]

[χ 13]

[χ 14]

Haplogroup I-M253

Contents

Origins[]

Subclades[]

Distribution by population[]

Publicly accessible databases[]

Britain[]

Famous Figures[]

Mutations[]

References[]

See also[]

Projects[]

Fan Feed