Haplogroup R1b (Y-DNA)
Talk0this wiki

Added by PhloxBotIn human genetics, Haplogroup R1b (M343) (previously called Hg1 and Eu18) is the most frequent Y-chromosome haplogroup in Europe.
Its frequency is highest in Western Europe, especially in Atlantic Europe (and due to European emigration, in North America, South America, and Australia). In southern England, the frequency of R1b is about 70%, and in parts of north and western England, Spain, Portugal, France, Wales, and Ireland, the frequency of R1b is greater than 90%.
Bryan Sykes in his book Blood of the Isles gives the populations associated with R1b the name of Oisín for a clan patriarch, much as he did for mitochondrial haplogroups in his work The Seven Daughters of Eve. Stephen Oppenheimer also deals with this population group in his book Origins of the British.
Contents |
Subclades
Edit
Haplogroup R1b is a descendant of Haplogroup R1 (M173). R1b is characterised by the presence of the M343 marker.
- R1b (M343)
R1b1c is Late Neolithic, not Paleolithic. Haplogroups I (male) and H (female) are contemporaneous in Western Europe c. 25-35,000 years ago. Cro-Magnon, the Aurignacian and most likely the Soluteran Culture were each defined by these 2 haplogroups. R1b came out of Central Asia, probably near present day Tajikistan, moved gradually westward along the steppe regions north of the Caspian and Black Seas. R1b entered Europe northwest of the Black Sea and brought in animal husbandry and some early farming techniques. Their movement westward, as R1 probably began about 18,000 years ago and they entered Europe, as R1b, during the last of the glacial age perhaps 10-11,000 ybp. Reaching the Iberian Peninsula, the most southwesterly foot of Europe maybe 6-7,000 ybp they intermingled with the Early Basque (mainly derived from haplogroups I and H), to make the Late Basque.
=== R1b1c ===
Most of the present-day European males with the M343 marker also have the P25 and M269 markers. These markers define the R1b1c subclade.
This subgroup probably originated in Central Asia/South Central Siberia, arriving from West Asia. The precise route of the M269 marker is not known. It appears to have entered prehistoric Europe c.5,000 ybp, mainly from the area of Ukraine/Belarus or Central Asia (Kazakhstan) via the coasts of the Black Sea and the Baltic Sea. It is considered widespread in Europe throughout the Late Neolithic.
A suggested alternative belief is that R1b represents the Western or centum-speaking branch of the Proto-Indo-Europeans, although this remains uncertain.
A second R1b1c population, reflected in a somewhat different distribution of haplotypes of the more rapidly varying Y-STR markers, appear to have survived alongside other haplogroups in Asia Minor, from where they spread out to repopulate Eastern Europe. However, they do not have the same dominance that R1b has in Western Europe. Instead the most common haplogroup in Eastern Europe is haplogroup R1a1, often thought to be associated with a subsequent migration of Indo-Europeans (or perhaps their ancestors) from the East.
Note that haplogroup R1b and haplogroup R1a first existed at very different times. The mutations that characterize haplogroup R1b occurred ~12-15,000 years bp, whereas the mutations that characterize haplogroup R1a occurred ~10-13,000 years bp.
(Note that in earlier literature the M269 marker, rather than M343, was used to define the R1b haplogroup. Then, for a time (from 2003 to 2005) what is now R1b1c was designated R1b3. This shows how nomenclature can evolve as new markers are discovered and then investigated).
To date the most commonly reported clade is R1b1c*. This implies that the individual is negative (ancestral) for all known subclade markers. R1b1c* is found at highest frequency in Iberia and Ireland with a decreasing cline to the east where the R1b subclade markers S21 and S28 are seen at increasingly higher frequency (beginning in Holland and Eastern France respectively). Until new subclade markers emerge, the most parsimonious interpretation is that R1b1c* reflects Late Neolithic populations. At this point the only option to obtain information on geographic and possibly tribal data for R1b1c* is to employ haplotype analysis of the Y-STR (short tandem repeat) markers. Various groupings have been identified such as "Southwest Irish" and "Scots (Pictish)" but the modal values for these are no longer available in one spot on the Internet. The clustering analysis of Dr. John McEwan [1]is an excellent starting point. Beyond this, further parsing of R1b1c* into subclades will be dependent on the success of commercial testing companies or academic researchers in locating new Y-SNPs.
The subclades R1b1c4 (M153) and R1b1c6 (SRY2627 (M167)) have been found to be typical of the Basque people; these subclades are only rarely found among Spaniards from other parts of Spain and are found sporadically among other European populations, which at one time was thought to indicate some sort of founder effect or genetic drift among a rather genetically isolated population of Basques. Now, it is believed that they simply overwhelmed, and mostly eliminated, the less formidable and smaller early Basque male population. Commercial testing has shown M167 to occur in Southwest England and Ireland, and to a lesser extent in Scotland. This haplogroup has also been reported from France (although a sampling bias may be at "fault" since relatively few French samples have been tested), and as far east as Germany. One problem that is critical to the understanding of the origin of R1b in Europe but which has been overlooked by popularizers of various theories is that the R1b frequency peak found in the Basque Country, Pyrenees, and southwestern France actually overlaps a zone of extremely decreased diversity of R1b-associated STR haplotypes.
The subclade R1b1c7 (M222), on the other hand, is associated with the Irish and Scots; in this case, the relatively high frequency of this specific subclade among the population of certain counties in northwestern Ireland may be due to positive social selection, as R1b1c7-M222 is believed to have been the Y-chromosome haplogroup of the kings of the Uí Néill clan of ancient Ireland and is about 2-3,000 years old. Accepted Ui Neill Y dna, as defined by Trinity College in Dublin, is signified by markers: 390 at 25, 391 at 13, and 392 at 11.
The R1b1c9 (S21) subclade, although recently discovered by EthnoAncestry, appears to be the most common downstream marker from R1b1c appearing in over 35% of those tested. This group has a maximum in Frisia (the Netherlands) and, in general, is the predominant R1b haplogroup. It may have originated perhaps more or less 3000 ybp, possibly in the northern European mainland.[2] The exact technical definition of the SNP was not initially released for commercial reasons, but the same marker was subsequently independently identified (as their "U106") by Sims et al (2007) [3].
The R1b1c9a subclade is defined by the L1/S26 SNP and is downsteam of S21. It occurs in less than a half a percent of R1b males, mainly with roots in the south and east of England and in Germany. L1 was first discovered by Family Tree DNA, then confirmed and named S26 by EthnoAncestry. L1/S26 is located in the flanking region of DYS439, and when it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or "null439". FTDNA displays null alleles at DYS439 with a Blue 12 on public pages, and with a Blue asterisk beside 439 on personal results pages. Other testing companies do report detecting null 439s. For further information, see the null439 project at [4].
The R1b1c9b subclade is defined by S29 and is downsteam of S21. It was discovered by EthnoAncestry, and has to date been found primarily in southern England (although this may reflect a sampling bias). Recent findings show that it also occurs in Germany in the region previously inhabited by the Saxons. Further studies will serve to ascertain whether this is a native Briton marker, or Continental and having arrived in England with the Anglo - Saxons in the 5th Century.
The R1b1c10 (S28) subclade's discovery was announced in 2005 by EthnoAncestry. Although sample sizes are relatively small, it appears to reach a maximum in Alpine Germany and Switzerland. Ethnoancestry's commercial and research branches have shown that S28 is found from Greece westward to the Bay of Biscay in France. It appears to follow the distribution of the La Tene Celtic peoples. To date all findings in Britain are only from locations known to be settled by the Norse (e.g., Orkney) and Danes (e.g., English Danelaw) probably during Viking times. The percentages there are much less than found in the Alps. It has yet to be found anywhere in Ireland or Spain. Northern Italy seems to be a meeting place for both S21 and S28. Like S21, S28's specifications were not initially officially published by EthnoAncestry against their previous assertations that data would be publicly published; but again the marker was subsequently identified independently (as their "U152") by Sims et al (2007). [5]
The newest Y-SNP to surface is S68, which was reported by EthnoAncestry in 2007. It was originally considered to be what was once referred to as a "private SNP" and by EthnoAncestry as a "Family SNP", but was recently seen in someone from another part of Europe, and with a different surname. It is only with continued research that the time depth of these markers can be estimated. At present S68 has been seen in an individual from Scotland and another from Sweden. EthnoAncestry has determined that this subclade (tentatively identified as R1b1c11) is unlikely to be found in much more than 2% of the R1b population and is thus not considered a polymorphism.
Other subclades
Edit
Populations characterised as R1b1a (M18), R1b1b (M73), and R1b1d (M335), with those mutually exclusive distinctive markers but no M269 have been found, in Sardinia, Eurasia, and Anatolia respectively. It is presumed that these are descendants of R1b1 populations who entered Europe along coastal routes.
An apparent R1b1* population has been found among the Ouldeme of Northern Cameroon in west central Africa. [6] [7]
Modal haplotypes
Edit
Within the R1b haplogroup are modal haplotypes. One of the best-characterized of these haplotypes is the Atlantic Modal Haplotype (AMH). This haplotype reaches the highest frequencies in the Iberian Peninsula and in the British Isles. In the Iberian Peninsula it reaches 33% in Portugal.
There also exists a haplotype of R1b with the DYS393=12 which is known in the literature as Haplotype 35, or ht35, as opposed to the AMH which is known as haplotype 15. They can be found in high numbers in Southeastern Europe and Western Asia. The members of this haplotype are thought to be descended from early R1b's who found shelter in Anatolia. They can be found in high numbers in the Armenian Highland and Armenia with smaller numbers throughout the Middle East, in Jewish populations, in Southeastern Europe, and in the Caucasus Mountains. There is also a sizable pocket of ht35 in Uyghur populations in western China, which is thought to be a remnant of the Tocharians, an Indo-European speaking people that inhabited the Tarim Basin in Central Asia until they were later absorbed by various Turkic peoples. Ht35 is also present in Britain in areas that were found to have a high concentration of Haplogroup J, suggesting they arrived together, perhaps through Roman soldiers. For further information and different subgroups of ht35, see [8] .
- R1b Modal Haplotype. Ysearch 55GU9
- R1b Modal Ysearch C7BED
- R1b (NW Irish) Modal Ysearch M5UKQ
- Comparison
Niall of the Nine Hostages
Edit
In 2006, a subgroup of R1b common among people of Irish patrilineal descent was identified as the probable haplotype of many within the septs associated with Niall of the Nine Hostages, an Irish king in the Dark Ages. SNP testing has shown that the cluster of haplotypes purported to be associated with the patrilineal descendants of the Uí Néill clan displays the M222 mutation that defines Haplogroup R1b1c7.
Relationship to other haplogroups
Edit
| Y-most recent common ancestor | ||||||||||||||||||||||
| | | ||||||||||||||||||||||
| A | BR | |||||||||||||||||||||
| B | CR | |||||||||||||||||||||
| C | DE | F | ||||||||||||||||||||
| D | E | G | H | IJ | K | |||||||||||||||||
| I | J | L | M | NO | P | |||||||||||||||||
| N | O | Q | R | |||||||||||||||||||
| Haplogroup R |
| |||||||||||||||
| |
Technical specification of mutation
Edit
The technical details of M343 are:
- Nucleotide change: C to A
- Position (base pair): 402
- Total size (base pairs): 424
- Forward 5′→ 3′: tttaacctcctccagctctgca
- Reverse 5′→ 3′: acccccacatatctccagg
This refers to a particular 424 base pair fragment of DNA that the polymerase chain reaction produces when one uses the two "primer" strands listed.
See also
Edit
References
Edit
- Luigi Luca Cavalli-Sforza (1994). The History and Geography of Human Genes. Princeton University Press. ISBN 0-691-08750-4
- Semino et al (2000), The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans, Science, Vol 290
- Wells et al (2001), The Eurasian Heartland: A continental perspective on Y-chromosome diversity, PNAS, Vol 98
- C. Cinnioglu et al. (2004), Excavating Y-chromosome haplotype strata in Anatolia, Human Genetics 114(2):127-48.
Notes
Edit
External links
Edit
- Map of R1b
- Haplogroup R1b distribution map
- International Society of Genetic Genealogy - 2006 tree of haplogroup R
- Spread of R1b, from the Genographic Project, National Geographic
- R1b1c Subclade Maps: M167, M222, S21, S28
- EthnoAncestry's Map of R1b with S21, S29 Subclades
- World Haplogroup Maps Note especially the dominance of R1b in Western Europe.
- Worldfamilies.net Page on Haplogroups
- Danish Demes Regional DNA Project: Haplogroup R1b
- null439 project
- Travels on a DNA Molecule Midgley
- Wade Surname Homepage
- General SNP Marker Page DNA Heritage
- John McEwan's Y Chromosome DNA Genealogy Page
| This page uses content from the English language Wikipedia. The original content was at Haplogroup R1b (Y-DNA). The list of authors can be seen in the page history. As with this Familypedia wiki, the content of Wikipedia is available under the Creative Commons License. |