Fandom

Familypedia

List of binary polymorphisms

215,617pages on
this wiki
Add New Page
Talk0 Share

Ad blocker interference detected!


Wikia is a free-to-use site that makes money from advertising. We have a modified experience for viewers using ad blockers

Wikia is not accessible if you’ve made further modifications. Remove the custom ad blocker rule(s) and the page will load as expected.

Mutation number Nucleotide change Position (base pair) Total size (base pairs) Position Forward 5′→3′ Reverse 5′→3′
M1 (YAP) 291bp insertion
M2 A to G 168 209 aggcactggtcagaatgaag aatggaaaatacagctcccc
M3
M4
M8
M9
M15
M17
M20
M33
M35
M38
M40
M42
M45
M52
M55
M57
M60
M64.1
M75
M89
M91
M94
M95
M96
M105
M122
M124
M130
M131
M132
M139
M145
M170
M172
M173
M174
M175
M176
M179
M201
M203
M207
M213
M214
M216
M217
M231 G to A 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg
M241 G to A 54 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc
M242 C to T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc
M253 C to T 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt
M258
M267 T to G 148 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M268
M285 G to C 70 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M286 G to A 129 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M287 A to T 100 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M299
M304 A to C 421 527 caaagtgctgggattacagg cttctagcttcatctgcattgt
M306
M335 T to A 162 417 aagaaatgttgaactgaaagttgat aggtgtatctggcatccgtta
M339 T to G 285 517 aggcaggacaactgagagca tgcttgatcctgggaagt
M340 G to C 218 386 ccagtcagcagtacaaaagttg gcatttctttgattatagaagcaa
M342 C to T 52 173 agagagttttctaacagggcg tgggaatcacttttgcaact
M343 C to A 402 424 tttaacctcctccagctctgca acccccacatatctccagg
M347
M349 G to T 209 493 tgggattaaaggtgctcatg caaaattggtaagccattagct
M356
M359 T to C 122 447 cgtctatggccttgaaga tccgaaaatgcagacttt
M365 A to G 246 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M367 A to G 196 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M368 A to C 200 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M369 G to C 45 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M370 C to G 166 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg

External links Edit

See alsoEdit

This page uses content from the English language Wikipedia. The original content was at List of binary polymorphisms. The list of authors can be seen in the page history. As with this Familypedia wiki, the content of Wikipedia is available under the Creative Commons License.

Also on Fandom

Random Wiki